이 방법은 미생물 다양성에 대한 심층적인 통찰을 제공하며, 다양한 연구 및 진단 응용 분야에서 매우 유용한 도구로 활용될 수 있습니다.
서비스
16S/18S/ITS 엠플리콘 시퀀싱
16S/18S/ITS 엠플리콘 메타유전체 시퀀싱은 특정 영역(엠플리콘)을 표적으로 하여 심층 분석을 수행하는 DNA 시퀀싱 방법입니다. 이 접근법은 보존된 유전자 또는 유전자 간 영역의 짧은 하이퍼가변 영역(<500bp)을 PCR로 증폭한 후, 차세대 시퀀싱(NGS)을 통해 분석합니다. 이를 통해 복잡한 샘플 내 다양한 미생물 종을 식별하고 구별할 수 있습니다.
엠플리콘 메타유전체 시퀀싱은 박테리아 및 고세균의 경우 16S rRNA 유전자, 진핵생물의 경우 18S rRNA 유전자, 곰팡이(효모, 곰팡이 및 기타 관련 종 포함)의 경우 ITS(Internal Transcribed Spacer) 영역을 타겟으로 하여 계통분석 및 분류학적 분석을 수행할 수 있습니다.
Novogene의 엠플리콘 메타유전체 시퀀싱 서비스는 Shotgun 메타유전체 시퀀싱에 비해 비용 효율적인 접근법을 제공하며, 타겟 생물체를 스크리닝하고 복잡한 미생물 군집의 다양성에 대한 통찰을 제공합니다. 이 방법은 미생물 생태학 연구, 특정 미생물 군의 계통 분석, 순수 배양된 종의 동정, 병원성 또는 유익한 생물체의 검출 등 다양한 분야에서 널리 활용되고 있습니다.
응용 분야 (Applications)
Amplicon 메타유전체 시퀀싱은 다양한 샘플에서 미생물의 전체 스펙트럼을 탐색할 수 있는 강력한 분석 기법입니다. 미생물 다양성에 대한 정밀한 통찰을 제공하며, 연구 및 진단 분야에서 매우 유용한 도구로 활용되고 있습니다. 특히 다음과 같은 분야에 효과적입니다:
- 복잡한 미생물 군집 내 관심 생물체를 정확하게 타겟팅하고 식별
- 광범위한 미생물의 주석(annotation) 및 분류를 통해 미생물 군집의 포괄적인 프로파일 제공
- 세균과 고세균(16S), 진핵 미생물(ITS/18S)(예: 곰팡이, 원생생물 등)을 구분하여 정밀한 분류학적 분석 가능
- 병원균, 미생물 오염, 유익한 토양 박테리아 등 다양한 미생물의 검출
- 체액 또는 조직 샘플을 분석하여 질병 및 암 진단을 보조
노보진 서비스의 장점 및 특징
노보진은 short-read 과 long-read (full-length 16S) 시퀀싱 기술을 기반으로 한 고급 앰플리콘 메타유전체 시퀀싱 서비스를 제공합니다. 풍부한 프로젝트 경험을 바탕으로 새롭게 개발된 분석 파이프라인은 미생물 군집에 대한 고해상도이며 정확한 인사이트를 제공합니다.
노보진은 다양한 연구 목적에 맞춘 맞춤형 프라이머 설계를 포함하여, 실험 설계에 있어 탁월한 유연성을 제공합니다.
Qiime 1 파이프라인을 통한 OTU 기반 클러스터링과 Qiime 2에서 DADA2를 활용한 고해상도 ASV 디노이징을 모두 지원하며, 연구자가 목적에 가장 적합한 접근 방식을 선택할 수 있도록 합니다. 또한 두 파이프라인 모두에서 맞춤형 분석 솔루션과 데이터베이스 통합을 제공하여, 특정 연구 요구사항에 정확하게 부합하는 결과를 제공합니다.
Amplicon 메타유전체 시퀀싱에 적용되는 프라이머
Types | Amplified Region | Fragment Length | Primers | Sequences (5’- 3’) |
Bacterial 16S | V4 | 300 bp | 515F | GTGCCAGCMGCCGCGGTAA |
806R | GGACTACHVGGGTWTCTAAT | |||
V3-V4 | 470 bp | 341F | CCTAYGGGRBGCASCAG | |
806R | GGACTACNNGGGTATCTAAT | |||
V4-V5 | 450 bp | 515F | GTGCCAGCMGCCGCGGTAA | |
907R | CCGTCAATTCCTTTGAGTTT | |||
V5-V7 (for endophytic) | 435 bp | 799F | AACMGGATTAGATACCCKG | |
1193R | ACGTCATCCCCACCTTCC | |||
Archaea V4 (AKA. Novel Archaea V4) | V4-V5 | 415 bp | Arch519F | CAGCCGCCGCGGTAA |
Arch915R | GTGCTCCCCCGCCAATTCCT |
Types | Amplified Region | Fragment Length | Primers | Sequences (5’- 3’) |
Fungal 18S | V4 | 350 bp | 528F | GCGGTAATTCCAGCTCCAA |
706R | AATCCRAGAATTTCACCTCT | |||
Fungal ITS | ITS1 | 200-400 bp | ITS5-1737F | GGAAGTAAAAGTCGTAACAAGG |
ITS2-2043R | GCTGCGTTCTTCATCGATGC | |||
ITS2 | 380 bp | ITS3-2024F | GCATCGATGAAGAACGCAGC | |
ITS4-2409R | TCCTCCGCTTATTGATATGC | |||
ITS1-1F (for endophytic) | 200-400 bp | ITS1-1F-F | CTTGGTCATTTAGAGGAAGTAA | |
ITS1-1F-R | GCTGCGTTCTTCATCGATGC |
사양: 시퀀싱 및 분석
Sample Type | Amount | Volume | Concentration | Purity |
Total DNA | ≥ 200 ng | ≥ 20 μL | ≥ 10 ng/μL | OD260/280 = 1.8-2.0, No degradation, no contamination, no color |
사양: 시퀀싱 및 분석
Sequencing Platform | Illumina NovaSeq System | |
Sequencing Strategy | NovaSeq Reagent (500 Cycles) | |
Data Output | 50K/100K/500K raw tags | |
Qiime1 or Qiime2 | Standard Analysis |
• Data Quality Control |
Advanced Analysis |
• Spearman, CCA/RDA, VPA analysis | |
프로젝트 진행 과정
노보진은 프로젝트의 모든 과정에서 최고 수준의 품질과 전문적인 서비스를 제공하여 연구자들이 신뢰할 수 있는 결과를 얻을 수 있도록 지원합니다. 모든 단계는 엄격한 과학적 기준에 따라 설계되고 수행되며, 시퀀싱 데이터의 정확성과 신뢰성을 보장하기 위해 철저한 품질 관리(QC) 절차가 적용됩니다.
전체 워크플로우는 샘플 준비 및 정량화, DNA 절단 및 라이브러리 제작, 라이브러리 품질 검증, 시퀀싱, 생물정보 분석 등의 주요 단계로 이루어져 있습니다.
Publications with Amplicon Metagenomic Sequencing
Amplicon Metagenomic Sequencing is a powerful tool for researchers aiming at the identification and differentiation of microbial species, either using OTUs or ASVs. With 16S/18S/ITS rRNA sequencing results, the microbial diversity of the environment through the Alpha (α) and Beta (β) diversity analysis can be characterized, to identify, describe, and track microorganisms of interest. Here is a list of featured publications that have used Novogene Amplicon Metagenomic Sequencing services.
Resources, Conservation, and RecyclingIssue Date: 14 April 2022 IF: 13.716 DOI: 10.1016/j.resconrec.2022.106348
Reference information
Tian, Lili & Song, Jintong & Ren, Yuanyuan & Zhao, Qian & Li, Yi & Luo, Xi & li, Nan & Li, Tian & Wang, Xin. (2022). Biosynthesis and recycling of magnetite nanocatalysts from Fe-rich sludge. Resources Conservation and Recycling. 182. 106348..
Journal of Hazardous MaterialsIssue Date: 3 February 2022 IF: 10.58 DOI: 10.1016/j.jhazmat.2022.128396
Reference Information
Wang, Ao et al. “Synergetic effects of microbial-phytoremediation reshape microbial communities and improve degradation of petroleum contaminants.”Journal of hazardous materials vol. 429 (2022): 128396.
Pharmaceuticals (Basel)Issue Date: 11 July 2022 IF: 5.215 DOI: 10.3390/ph15070850
Reference information
Schmidt, Kenneth et al. “Characterization of the Mucosally-Adherent Duodenal Microbiome in Children with and without Crohn’s Disease.”Pharmaceuticals (Basel, Switzerland) vol. 15,7 850. 11 Jul. 2022.
GigaScienceIssue Date: 23 September 2021 IF: 7.658 DOI: 10.1093/gigascience/giab067
Reference information
Su, Yuan et al. “Association of female reproductive tract microbiota with egg production in layer chickens.” GigaScience vol. 10,9 (2021): giab067. .
Frontiers in ImmunologyIssue Date: 8 March 2021 IF: 7.97 DOI: 10.3389/fimmu.2021.640767
Reference information
Yin, Zhaoyang et al. “Early Life Intervention Using Probiotic Clostridium butyricum Improves Intestinal Development, Immune Response, and Gut Microbiota in Large Yellow Croaker (Larimichthys crocea) Larvae.” Frontiers in immunology vol. 12 640767. 8 Mar. 2021..
Reference information
Chen, K., Luan, X., Liu, Q., Wang, J., Chang, X., Snijders, A. M., … & Wang, Z. (2019). Drosophila histone demethylase KDM5 regulates social behavior through immune control and gut microbiota maintenance. Cell host & microbe, 25(4), 537-552.
Bioresource TechnologyIssue Date: January 2019 IF: 7.539 DOI: 10.1016/j.biortech.2018.10.045
Reference information
Duan, Y., Awasthi, S. K., Chen, H., Liu, T., Zhang, Z., Zhang, L., … & Taherzadeh, M. J. (2019). Evaluating the impact of bamboo biochar on the fungal community succession during chicken manure composting. Bioresource technology, 272, 308-314.
MicrobiomeIssue Date: 03 April 2018 IF: 11.607 DOI: 10.1186/s40168-018-0441-4
Reference information
Zhou, X., Li, J., Guo, J., Geng, B., Ji, W., Zhao, Q., … & Cai, W. (2018). Gut-dependent microbial translocation induces inflammation and cardiovascular events after ST-elevation myocardial infarction. Microbiome, 6(1), 1-17.
Nature CommunicationsIssue Date: 09 January 2017 IF: 12.121 DOI: 10.1038/ncomms13839
Reference information
Li, F., Hao, X., Chen, Y., Bai, L., Gao, X., Lian, Z., … & Tian, Z. (2017). The microbiota maintain homeostasis of liver-resident γδT-17 cells in a lipid antigen/CD1d-dependent manner. Nature communications, 8(1), 1-15.
MicrobiomeIssue Date: 01 February 2017 IF: 11.607 DOI: 10.1186/s40168-016-0222-x
Reference information
Li, J., Zhao, F., Wang, Y., Chen, J., Tao, J., Tian, G., … & Zhang, W. (2017). Gut microbiota dysbiosis contributes to the development of hypertension. Microbiome, 5(1), 1-19.
Novogene's Qiime2 Analysis Pipeline
Function prediction은 Qiime2의 기본 분석 파이프라인에 포함되어 있습니다.
The evolutionary tree in genus
계통수의 가지 색상은 서로 다른 문(phylum)을 나타냅니다. 원 외곽에 표시된 막대는 각 그룹에서의 속(genus) 수준 상대 풍부도(relative abundance)를 나타내며, 색상은 그룹 간 차이를 구분합니다.
Alpha Diversity- Rarefaction Curves
희소화 곡선에서 각 곡선은 하나의 샘플을 나타내며, 매핑 파일에 지정된 샘플 이름에 따라 색상과 모양이 구분됩니다. X축은 시퀀스 수, Y축은 관찰된 OTU(Operational Taxonomic Units) 수를 나타냅니다.
Network Analysis
각 노드는 하나의 속(genus)을 나타냅니다. 노드의 크기는 해당 속의 평균 상대 풍부도를 의미하며, 동일한 문(phylum)에 속한 노드는 동일한 색상으로 표시됩니다. 노드 간 선(엣지)의 두께는 종 간 상호작용의 상관 계수 절대값에 비례하며, 선의 색상은 상관 방향을 나타냅니다 (빨간색은 양의 상관, 파란색은 음의 상관을 의미합니다).
Spearman Correlation Test
행(Row)은 환경 요인을, 열(Column)은 종(species)을 나타냅니다. 색으로 구분된 타일은 스피어만 순위 상관 계수(r)를 의미하며, r 값의 범위는 -1에서 1까지입니다.
r < 0: 음의 상관관계
r > 0: 양의 상관관계
* 기호는 통계적으로 유의함을 나타냅니다 (p < 0.05)
샷건 메타지놈 시퀀싱